Transcript: Mouse XM_011250490.2

PREDICTED: Mus musculus zinc finger protein 94 (Zfp94), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zfp94 (22756)
Length:
2657
CDS:
437..1897

Additional Resources:

NCBI RefSeq record:
XM_011250490.2
NBCI Gene record:
Zfp94 (22756)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011250490.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000415800 GCGTTGTTGTCTATGACAAAT pLKO_005 2391 3UTR 100% 13.200 10.560 N Zfp94 n/a
2 TRCN0000085082 CAGCAAACATTCCGGTCAGAA pLKO.1 775 CDS 100% 4.950 3.465 N Zfp94 n/a
3 TRCN0000085079 GCAGAGTAAGCATCAGGGAAA pLKO.1 705 CDS 100% 4.050 2.835 N Zfp94 n/a
4 TRCN0000085080 GCCTCCAACTTTCTGGCTCAT pLKO.1 1547 CDS 100% 4.050 2.835 N Zfp94 n/a
5 TRCN0000085081 GCTCGGAGTTTAACAATCACA pLKO.1 1128 CDS 100% 3.000 2.100 N Zfp94 n/a
6 TRCN0000425489 AGTCAGAACCTTGACCTTTAA pLKO_005 2058 3UTR 100% 13.200 6.600 Y Zfp94 n/a
7 TRCN0000015352 CGGGAGAGAAACCTTACAAAT pLKO.1 1665 CDS 100% 13.200 6.600 Y ZNF85 n/a
8 TRCN0000096537 CTGGAGAGAAACCCTACAAAT pLKO.1 1245 CDS 100% 13.200 6.600 Y Zfp934 n/a
9 TRCN0000235358 CTGGAGAGAAACCCTACAAAT pLKO_005 1245 CDS 100% 13.200 6.600 Y 2810408B13Rik n/a
10 TRCN0000244342 CTGGAGAGAAACCCTACAAAT pLKO_005 1245 CDS 100% 13.200 6.600 Y EG668616 n/a
11 TRCN0000417145 GGAGTTGTAGTATTAGTATTT pLKO_005 1959 3UTR 100% 13.200 6.600 Y Zfp94 n/a
12 TRCN0000016346 CACTGGAGAGAAACCCTACAA pLKO.1 1243 CDS 100% 4.950 2.475 Y ZNF254 n/a
13 TRCN0000085078 CCCAACTCTTAGAGTTCTCAA pLKO.1 1937 3UTR 100% 4.950 2.475 Y Zfp94 n/a
14 TRCN0000158848 GAGAAACCTTACAAATGTGAT pLKO.1 1670 CDS 100% 4.950 2.475 Y ZNF28 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011250490.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.