Transcript: Mouse XM_011250912.2

PREDICTED: Mus musculus protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 3 (Ppfia3), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ppfia3 (76787)
Length:
4697
CDS:
355..3939

Additional Resources:

NCBI RefSeq record:
XM_011250912.2
NBCI Gene record:
Ppfia3 (76787)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011250912.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000109949 CTATGGTATTATGTGCCTGAA pLKO.1 3378 CDS 100% 4.050 3.240 N Ppfia3 n/a
2 TRCN0000272590 ATGAACGATGACCACAATAAG pLKO_005 1618 CDS 100% 13.200 9.240 N PPFIA3 n/a
3 TRCN0000109945 CCTGGACCAAACCATAAGAAA pLKO.1 4058 3UTR 100% 5.625 3.938 N Ppfia3 n/a
4 TRCN0000109948 CGGTTACAGCTTCACCTCAAA pLKO.1 1684 CDS 100% 4.950 3.465 N Ppfia3 n/a
5 TRCN0000109946 GCTAACATGAAGAAACTTCAA pLKO.1 1753 CDS 100% 4.950 3.465 N Ppfia3 n/a
6 TRCN0000109947 CCTGAAGGAATTTGCTACGAA pLKO.1 3516 CDS 100% 3.000 2.100 N Ppfia3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011250912.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.