Transcript: Human XM_011509310.2

PREDICTED: Homo sapiens activating transcription factor 6 (ATF6), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ATF6 (22926)
Length:
2180
CDS:
42..1829

Additional Resources:

NCBI RefSeq record:
XM_011509310.2
NBCI Gene record:
ATF6 (22926)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011509310.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000416318 ACAGAGTCTCTCAGGTTAAAT pLKO_005 1518 CDS 100% 15.000 12.000 N ATF6 n/a
2 TRCN0000422209 GACACATCAGATGGTATTATC pLKO_005 1323 CDS 100% 13.200 10.560 N ATF6 n/a
3 TRCN0000429629 GATGATAGTATTGGCATTTAT pLKO_005 1184 CDS 100% 15.000 10.500 N ATF6 n/a
4 TRCN0000422247 CAGAGAACCAGAGGCTTAAAG pLKO_005 1132 CDS 100% 13.200 9.240 N ATF6 n/a
5 TRCN0000428648 CAGACAGTACCAACGCTTATG pLKO_005 657 CDS 100% 10.800 7.560 N ATF6 n/a
6 TRCN0000017853 CCCAGAAGTTATCAAGACTTT pLKO.1 1743 CDS 100% 4.950 3.465 N ATF6 n/a
7 TRCN0000017857 CCTAGTCCAAAGCGAAGAGTT pLKO.1 1155 CDS 100% 4.950 3.465 N ATF6 n/a
8 TRCN0000017855 GCAGCAACCAATTATCAGTTT pLKO.1 689 CDS 100% 4.950 3.465 N ATF6 n/a
9 TRCN0000017854 CCTCAAGTTATTCAGTCTCAT pLKO.1 331 CDS 100% 4.950 3.465 N ATF6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011509310.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11651 pDONR223 100% 33.5% 33.1% None (many diffs) n/a
2 ccsbBroad304_11651 pLX_304 93.4% 33.5% 33.1% V5 (many diffs) n/a
3 TRCN0000466755 TGAGAGTTTTCAACTTTGCGAACA pLX_317 63.5% 33.5% 33.1% V5 (many diffs) n/a
Download CSV