Transcript: Human XM_011509455.2

PREDICTED: Homo sapiens heparin binding growth factor (HDGF), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HDGF (3068)
Length:
2104
CDS:
138..764

Additional Resources:

NCBI RefSeq record:
XM_011509455.2
NBCI Gene record:
HDGF (3068)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011509455.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000118161 CTTCCCTTACGAGGAATCCAA pLKO.1 230 CDS 100% 3.000 4.200 N HDGF n/a
2 TRCN0000307876 CTTCCCTTACGAGGAATCCAA pLKO_005 230 CDS 100% 3.000 4.200 N HDGF n/a
3 TRCN0000118157 GCCAGCTTATAGTCATATATA pLKO.1 1596 3UTR 100% 15.000 10.500 N HDGF n/a
4 TRCN0000307873 GCCAGCTTATAGTCATATATA pLKO_005 1596 3UTR 100% 15.000 10.500 N HDGF n/a
5 TRCN0000118158 CGAGAACAACCCTACTGTCAA pLKO.1 308 CDS 100% 4.950 3.465 N HDGF n/a
6 TRCN0000307869 CGAGAACAACCCTACTGTCAA pLKO_005 308 CDS 100% 4.950 3.465 N HDGF n/a
7 TRCN0000118159 GAACGAGAAAGGAGCGTTGAA pLKO.1 485 CDS 100% 4.950 3.465 N HDGF n/a
8 TRCN0000291922 GAACGAGAAAGGAGCGTTGAA pLKO_005 485 CDS 100% 4.950 3.465 N HDGF n/a
9 TRCN0000089225 GCCAACAAATACCAAGTCTTT pLKO.1 165 CDS 100% 4.950 3.465 N Hdgf n/a
10 TRCN0000118160 TGCCGTGAAATCAACAGCCAA pLKO.1 149 CDS 100% 2.640 1.848 N HDGF n/a
11 TRCN0000307878 TGCCGTGAAATCAACAGCCAA pLKO_005 149 CDS 100% 2.640 1.848 N HDGF n/a
12 TRCN0000413041 AGGAAGAAGAGGAGGAGGAAG pLKO_005 679 CDS 100% 4.050 2.025 Y Myt1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011509455.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06358 pDONR223 100% 86.3% 86.6% None 0_1ins96;174G>A;552G>A n/a
2 ccsbBroad304_06358 pLX_304 0% 86.3% 86.6% V5 0_1ins96;174G>A;552G>A n/a
3 TRCN0000470424 ATTGACTAATAATCTATTTACCTC pLX_317 62% 86.3% 86.6% V5 0_1ins96;174G>A;552G>A n/a
Download CSV