Transcript: Human XM_011509457.2

PREDICTED: Homo sapiens complement factor H related 1 (CFHR1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CFHR1 (3078)
Length:
1103
CDS:
116..913

Additional Resources:

NCBI RefSeq record:
XM_011509457.2
NBCI Gene record:
CFHR1 (3078)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011509457.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000160558 CTTTATTTGAGAACAGGTGAA pLKO.1 782 CDS 100% 4.050 2.430 N CFHR1 n/a
2 TRCN0000166213 CTGGAAGGTGATACTGTGCAA pLKO.1 233 CDS 100% 2.640 1.584 N CFHR1 n/a
3 TRCN0000159770 GATGAAGAAGTGATGTGTTTA pLKO.1 473 CDS 100% 13.200 6.600 Y CFHR1 n/a
4 TRCN0000162296 CTTGAGGGTAACAAGCGAATA pLKO.1 647 CDS 100% 10.800 5.400 Y CFHR1 n/a
5 TRCN0000161806 CGTGTGTAATATCCCGAGAAA pLKO.1 714 CDS 100% 4.950 2.475 Y CFHR1 n/a
6 TRCN0000159479 CTTCATCAGTTGAGTACCAAT pLKO.1 609 CDS 100% 4.950 2.475 Y CFHR1 n/a
7 TRCN0000158988 GAGAACAACATTTCATGTGTA pLKO.1 290 CDS 100% 4.950 2.475 Y CFHR2 n/a
8 TRCN0000162471 CAAACACATCTGGAAGGTGAT pLKO.1 224 CDS 100% 4.050 2.025 Y CFHR2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011509457.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00735 pDONR223 100% 56.7% 51.5% None (many diffs) n/a
2 ccsbBroad304_00735 pLX_304 0% 56.7% 51.5% V5 (many diffs) n/a
3 TRCN0000475488 CCGCGAATTTATTCCGGCGTGAGA pLX_317 49.8% 56.7% 51.5% V5 (many diffs) n/a
Download CSV