Transcript: Human XM_011509600.1

PREDICTED: Homo sapiens ribosomal RNA adenine dimethylase domain containing 1 (RRNAD1), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RRNAD1 (51093)
Length:
1606
CDS:
170..1399

Additional Resources:

NCBI RefSeq record:
XM_011509600.1
NBCI Gene record:
RRNAD1 (51093)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011509600.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000414929 TAACAGCTCCATTCCGGAAAC pLKO_005 336 CDS 100% 6.000 8.400 N RRNAD1 n/a
2 TRCN0000417086 TGTTGCCTTGCTGAGACACTT pLKO_005 763 CDS 100% 4.950 3.960 N RRNAD1 n/a
3 TRCN0000129584 CTAACAGCTCCATTCCGGAAA pLKO.1 335 CDS 100% 4.050 3.240 N RRNAD1 n/a
4 TRCN0000146710 CGAGCTCAAGATTGAAGAATA pLKO.1 1075 CDS 100% 13.200 9.240 N RRNAD1 n/a
5 TRCN0000183184 GAGCTCAAGATTGAAGAATAT pLKO.1 1076 CDS 100% 13.200 9.240 N RRNAD1 n/a
6 TRCN0000414073 AGTGGGCTGCTGCTACATGAA pLKO_005 817 CDS 100% 4.950 3.465 N RRNAD1 n/a
7 TRCN0000196232 GAAACATGTCAGGCCCAAGAA pLKO.1 352 CDS 100% 4.950 3.465 N RRNAD1 n/a
8 TRCN0000196156 GCAGAGTACATCTCATCCAGA pLKO.1 1458 3UTR 100% 2.640 1.848 N RRNAD1 n/a
9 TRCN0000173738 CCTGAACTCTCTCCCAGAAAT pLKO.1 1310 CDS 100% 13.200 7.920 N Rrnad1 n/a
10 TRCN0000336016 CCTGAACTCTCTCCCAGAAAT pLKO_005 1310 CDS 100% 13.200 7.920 N Rrnad1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011509600.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08216 pDONR223 100% 86% 85.8% None 0_1ins198;1000G>C n/a
2 ccsbBroad304_08216 pLX_304 0% 86% 85.8% V5 0_1ins198;1000G>C n/a
Download CSV