Transcript: Human XM_011509688.1

PREDICTED: Homo sapiens Ral GEF with PH domain and SH3 binding motif 2 (RALGPS2), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RALGPS2 (55103)
Length:
7413
CDS:
271..1926

Additional Resources:

NCBI RefSeq record:
XM_011509688.1
NBCI Gene record:
RALGPS2 (55103)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011509688.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000416506 GCCATAGTTTGGGTTATAATT pLKO_005 1292 CDS 100% 15.000 21.000 N RALGPS2 n/a
2 TRCN0000420811 GGAATAGATCGTAGCTAATTT pLKO_005 2258 3UTR 100% 15.000 21.000 N RALGPS2 n/a
3 TRCN0000047284 CATTCCCTATTTAGGTATCTA pLKO.1 864 CDS 100% 5.625 7.875 N RALGPS2 n/a
4 TRCN0000047285 AGAAACTGTATGAGCTGAATA pLKO.1 656 CDS 100% 13.200 9.240 N RALGPS2 n/a
5 TRCN0000413161 GAGACTATATAAGTAGCTTAA pLKO_005 830 CDS 100% 10.800 7.560 N RALGPS2 n/a
6 TRCN0000423067 TGACAAGAGTGGCACGAAATG pLKO_005 1547 CDS 100% 10.800 7.560 N RALGPS2 n/a
7 TRCN0000047286 AGCAGTCTTGTGAATATGATA pLKO.1 998 CDS 100% 5.625 3.938 N RALGPS2 n/a
8 TRCN0000047287 GAAGAATATGCGGGTCAGATA pLKO.1 421 CDS 100% 4.950 3.465 N RALGPS2 n/a
9 TRCN0000047283 GCTTTCAAGTTGTGGATGGAA pLKO.1 486 CDS 100% 3.000 2.100 N RALGPS2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011509688.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03523 pDONR223 100% 94.5% 93.5% None 1628_1629ins92;1653_1654insTGAG n/a
2 ccsbBroad304_03523 pLX_304 0% 94.5% 93.5% V5 1628_1629ins92;1653_1654insTGAG n/a
Download CSV