Transcript: Human XM_011509689.3

PREDICTED: Homo sapiens G-patch domain containing 2 (GPATCH2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GPATCH2 (55105)
Length:
2633
CDS:
114..1769

Additional Resources:

NCBI RefSeq record:
XM_011509689.3
NBCI Gene record:
GPATCH2 (55105)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011509689.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430611 GAAACGAACCAGACCAATAAG pLKO_005 813 CDS 100% 13.200 18.480 N GPATCH2 n/a
2 TRCN0000434621 ATCTCTAACAAACGGACAATG pLKO_005 636 CDS 100% 10.800 15.120 N GPATCH2 n/a
3 TRCN0000413578 GCATGCATTTAGGATCCTTAT pLKO_005 1399 CDS 100% 10.800 15.120 N GPATCH2 n/a
4 TRCN0000414779 GTGATAGAGCCTACCAGTATC pLKO_005 697 CDS 100% 10.800 15.120 N GPATCH2 n/a
5 TRCN0000134820 CCGATGCTTTGCTTAATTCAT pLKO.1 2063 3UTR 100% 5.625 7.875 N GPATCH2 n/a
6 TRCN0000135375 GCACTGATGCTGGATTGTTTA pLKO.1 907 CDS 100% 13.200 10.560 N GPATCH2 n/a
7 TRCN0000420680 GATCCTGTCTTTGAAAGTATC pLKO_005 1068 CDS 100% 10.800 8.640 N GPATCH2 n/a
8 TRCN0000136461 CCAACTTCAATGGTACCCATT pLKO.1 1200 CDS 100% 0.000 0.000 N GPATCH2 n/a
9 TRCN0000134227 GCAGCTCGTTTCTCTTATTTA pLKO.1 2017 3UTR 100% 15.000 10.500 N GPATCH2 n/a
10 TRCN0000422357 ACTATAGAGAGAATCACAATA pLKO_005 418 CDS 100% 13.200 9.240 N GPATCH2 n/a
11 TRCN0000134147 CATCAGCTTCTGAGAGATAAT pLKO.1 1320 CDS 100% 13.200 9.240 N GPATCH2 n/a
12 TRCN0000133713 GAGACCATTCTCGAAGTATAT pLKO.1 265 CDS 100% 13.200 9.240 N GPATCH2 n/a
13 TRCN0000426497 GCACACCCACCAGTTTCTAAA pLKO_005 2121 3UTR 100% 13.200 9.240 N GPATCH2 n/a
14 TRCN0000217726 GCATCAGCTTCTGAGAGATAA pLKO.1 1319 CDS 100% 13.200 9.240 N Gpatch2 n/a
15 TRCN0000435000 TAACAAGAGAATGGTTCATTT pLKO_005 1235 CDS 100% 13.200 9.240 N GPATCH2 n/a
16 TRCN0000416209 CTTAAGTGAAGGCTCTGATTC pLKO_005 374 CDS 100% 10.800 7.560 N GPATCH2 n/a
17 TRCN0000419688 TGTGGACAATGTTGGGAATAG pLKO_005 560 CDS 100% 10.800 7.560 N GPATCH2 n/a
18 TRCN0000134117 CCGAACACATCTTTGTTTGAA pLKO.1 2224 3UTR 100% 5.625 3.938 N GPATCH2 n/a
19 TRCN0000179472 GCTTAAGTGAAGGCTCTGATT pLKO.1 373 CDS 100% 4.950 3.465 N Gpatch2 n/a
20 TRCN0000418265 ACTATGTCCCATTGTTCTAAA pLKO_005 1806 3UTR 100% 13.200 7.920 N GPATCH2 n/a
21 TRCN0000329580 CTGTCTTTGAAAGTATCTTAG pLKO_005 1072 CDS 100% 10.800 6.480 N Zfp110 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011509689.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12157 pDONR223 100% 67.7% 65.5% None (many diffs) n/a
2 ccsbBroad304_12157 pLX_304 0% 67.7% 65.5% V5 (many diffs) n/a
3 TRCN0000465316 CTTTACACTATGACCCAGCCACCA pLX_317 21% 67.7% 65.5% V5 (many diffs) n/a
Download CSV