Transcript: Human XM_011509694.3

PREDICTED: Homo sapiens G-patch domain containing 2 (GPATCH2), transcript variant X10, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GPATCH2 (55105)
Length:
1330
CDS:
114..1310

Additional Resources:

NCBI RefSeq record:
XM_011509694.3
NBCI Gene record:
GPATCH2 (55105)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011509694.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430611 GAAACGAACCAGACCAATAAG pLKO_005 813 CDS 100% 13.200 18.480 N GPATCH2 n/a
2 TRCN0000434621 ATCTCTAACAAACGGACAATG pLKO_005 636 CDS 100% 10.800 15.120 N GPATCH2 n/a
3 TRCN0000414779 GTGATAGAGCCTACCAGTATC pLKO_005 697 CDS 100% 10.800 15.120 N GPATCH2 n/a
4 TRCN0000135375 GCACTGATGCTGGATTGTTTA pLKO.1 907 CDS 100% 13.200 10.560 N GPATCH2 n/a
5 TRCN0000420680 GATCCTGTCTTTGAAAGTATC pLKO_005 1068 CDS 100% 10.800 8.640 N GPATCH2 n/a
6 TRCN0000422357 ACTATAGAGAGAATCACAATA pLKO_005 418 CDS 100% 13.200 9.240 N GPATCH2 n/a
7 TRCN0000133713 GAGACCATTCTCGAAGTATAT pLKO.1 265 CDS 100% 13.200 9.240 N GPATCH2 n/a
8 TRCN0000416209 CTTAAGTGAAGGCTCTGATTC pLKO_005 374 CDS 100% 10.800 7.560 N GPATCH2 n/a
9 TRCN0000419688 TGTGGACAATGTTGGGAATAG pLKO_005 560 CDS 100% 10.800 7.560 N GPATCH2 n/a
10 TRCN0000179472 GCTTAAGTGAAGGCTCTGATT pLKO.1 373 CDS 100% 4.950 3.465 N Gpatch2 n/a
11 TRCN0000329580 CTGTCTTTGAAAGTATCTTAG pLKO_005 1072 CDS 100% 10.800 6.480 N Zfp110 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011509694.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12157 pDONR223 100% 93.4% 91.9% None (many diffs) n/a
2 ccsbBroad304_12157 pLX_304 0% 93.4% 91.9% V5 (many diffs) n/a
3 TRCN0000465316 CTTTACACTATGACCCAGCCACCA pLX_317 21% 93.4% 91.9% V5 (many diffs) n/a
Download CSV