Transcript: Human XM_011509766.3

PREDICTED: Homo sapiens adenylate cyclase 10 (ADCY10), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ADCY10 (55811)
Length:
6398
CDS:
2473..5790

Additional Resources:

NCBI RefSeq record:
XM_011509766.3
NBCI Gene record:
ADCY10 (55811)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011509766.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000369931 TCCCTATTTCTCGGGAGATTT pLKO_005 4283 CDS 100% 13.200 18.480 N ADCY10 n/a
2 TRCN0000078372 CCGTACTGAGAAAGTCATGTT pLKO.1 3864 CDS 100% 4.950 6.930 N ADCY10 n/a
3 TRCN0000300029 CCGTACTGAGAAAGTCATGTT pLKO_005 3864 CDS 100% 4.950 6.930 N ADCY10 n/a
4 TRCN0000232732 AGCGACCCTTTATGGATTATT pLKO_005 2567 CDS 100% 15.000 12.000 N ADCY10 n/a
5 TRCN0000232735 ACAGACCAACCTTCGAAATAA pLKO_005 4200 CDS 100% 15.000 10.500 N ADCY10 n/a
6 TRCN0000232734 CCCTTTGCTGGGACGTAATAA pLKO_005 3924 CDS 100% 15.000 10.500 N ADCY10 n/a
7 TRCN0000078370 GCGACCCTTTATGGATTATTT pLKO.1 2568 CDS 100% 15.000 10.500 N ADCY10 n/a
8 TRCN0000232733 AGATCCTCAACTACCACATAA pLKO_005 2690 CDS 100% 13.200 9.240 N ADCY10 n/a
9 TRCN0000078371 CCTGTTCAAGTATTCCATTAA pLKO.1 4773 CDS 100% 13.200 9.240 N ADCY10 n/a
10 TRCN0000078368 GCTCAGATGAATGATGTTATT pLKO.1 3016 CDS 100% 13.200 9.240 N ADCY10 n/a
11 TRCN0000222741 GCTTCCATCAAACTTTCTATA pLKO.1 4118 CDS 100% 13.200 9.240 N ADCY10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011509766.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.