Transcript: Human XM_011510160.2

PREDICTED: Homo sapiens LEM domain containing 1 (LEMD1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LEMD1 (93273)
Length:
1045
CDS:
140..769

Additional Resources:

NCBI RefSeq record:
XM_011510160.2
NBCI Gene record:
LEMD1 (93273)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011510160.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000451451 GTCGCTGTTTGGTTAAGTAAT pLKO_005 754 CDS 100% 13.200 18.480 N LEMD1 n/a
2 TRCN0000445220 TAGTACAGTTGTTGGTCTCAC pLKO_005 252 CDS 100% 4.050 5.670 N LEMD1 n/a
3 TRCN0000148815 CCAGAATCACATATGGGACTA pLKO.1 594 CDS 100% 0.000 0.000 N LEMD1 n/a
4 TRCN0000183249 GCGAAGAGCTTAATATCATTT pLKO.1 339 CDS 100% 13.200 9.240 N LEMD1 n/a
5 TRCN0000252802 ATACTACCTTCCACCAGAAAG pLKO_005 215 CDS 100% 10.800 7.560 N Lemd1 n/a
6 TRCN0000149833 CCAACTTGAGAAGCTTGGATT pLKO.1 181 CDS 100% 4.950 3.465 N LEMD1 n/a
7 TRCN0000148273 CAGAATCACATATGGGACTAT pLKO.1 595 CDS 100% 0.000 0.000 N LEMD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011510160.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09356 pDONR223 100% 86.4% 86.1% None 247G>A;271_354del n/a
2 ccsbBroad304_09356 pLX_304 0% 86.4% 86.1% V5 247G>A;271_354del n/a
3 TRCN0000471726 ACAACCCAAATACTCTGAGTTATC pLX_317 83.1% 86.4% 86.1% V5 247G>A;271_354del n/a
Download CSV