Transcript: Human XM_011510366.2

PREDICTED: Homo sapiens syntrophin gamma 2 (SNTG2), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SNTG2 (54221)
Length:
1908
CDS:
506..1786

Additional Resources:

NCBI RefSeq record:
XM_011510366.2
NBCI Gene record:
SNTG2 (54221)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011510366.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000243238 ACGAAAGAGGTGCTGACAATT pLKO_005 423 5UTR 100% 13.200 18.480 N SNTG2 n/a
2 TRCN0000180547 GCTCGCATCTCAAGGTACAAA pLKO.1 845 CDS 100% 5.625 7.875 N SNTG2 n/a
3 TRCN0000180621 GCATTTCTGAAGCTCCCGTTA pLKO.1 644 CDS 100% 4.050 3.240 N SNTG2 n/a
4 TRCN0000243241 CTCGCATCTCAAGGTACAAAG pLKO_005 846 CDS 100% 10.800 7.560 N SNTG2 n/a
5 TRCN0000243239 TTACCATCACCGTTGAGTATC pLKO_005 609 CDS 100% 10.800 7.560 N SNTG2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011510366.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12034 pDONR223 100% 84.5% 75.2% None (many diffs) n/a
2 ccsbBroad304_12034 pLX_304 0% 84.5% 75.2% V5 (many diffs) n/a
3 TRCN0000471988 ATCCACCCTGGGGACTCACCTCAG pLX_317 9.6% 84.5% 75.2% V5 (many diffs) n/a
Download CSV