Transcript: Human XM_011510396.1

PREDICTED: Homo sapiens peroxidasin (PXDN), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PXDN (7837)
Length:
6606
CDS:
399..4289

Additional Resources:

NCBI RefSeq record:
XM_011510396.1
NBCI Gene record:
PXDN (7837)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011510396.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000246225 AGATTGCGACTGGACTCAAAC pLKO_005 405 CDS 100% 10.800 15.120 N PXDN n/a
2 TRCN0000246226 GTTCCTGACGTCAGTCGAAAT pLKO_005 1686 CDS 100% 10.800 15.120 N PXDN n/a
3 TRCN0000257468 ACACACTTCACTGCGACTGTG pLKO_005 424 CDS 100% 4.050 5.670 N PXDN n/a
4 TRCN0000246227 AGCGGCCATCTGTGAATATCC pLKO_005 503 CDS 100% 4.950 3.960 N PXDN n/a
5 TRCN0000191867 GAAGGATTCTTGACCATCAAT pLKO.1 1575 CDS 100% 5.625 3.938 N Pxdn n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011510396.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489796 TCGCCCCTTGGAGTGATACTTGGT pLX_317 7.2% 87.6% 87.6% V5 (not translated due to prior stop codon) 0_1ins549 n/a
Download CSV