Transcript: Human XM_011510472.2

PREDICTED: Homo sapiens abl interactor 2 (ABI2), transcript variant X11, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ABI2 (10152)
Length:
6522
CDS:
642..2120

Additional Resources:

NCBI RefSeq record:
XM_011510472.2
NBCI Gene record:
ABI2 (10152)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011510472.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000298633 GTCAGGTCTTCCCAGATTATC pLKO_005 2155 3UTR 100% 13.200 9.240 N ABI2 n/a
2 TRCN0000123125 GCTGTGGTTGAGTATAGTGAT pLKO.1 1872 CDS 100% 4.950 3.465 N ABI2 n/a
3 TRCN0000286491 GCTGTGGTTGAGTATAGTGAT pLKO_005 1872 CDS 100% 4.950 3.465 N ABI2 n/a
4 TRCN0000123124 CCAGTAAAGTAGAATGAAGGA pLKO.1 2198 3UTR 100% 2.640 1.848 N ABI2 n/a
5 TRCN0000293922 CTTCAAGGACACATAAGATTA pLKO_005 994 CDS 100% 13.200 7.920 N ABI2 n/a
6 TRCN0000164978 GTGGTGGCTTATGCCTGTAAT pLKO.1 4253 3UTR 100% 13.200 6.600 Y C9orf139 n/a
7 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 4265 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011510472.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02333 pDONR223 100% 78.4% 78.4% None 460_477del;577_578ins150;698_880del n/a
2 ccsbBroad304_02333 pLX_304 0% 78.4% 78.4% V5 460_477del;577_578ins150;698_880del n/a
3 TRCN0000468963 CATCACGGCCGAGAGATTGTAAAG pLX_317 27.8% 78.4% 78.4% V5 460_477del;577_578ins150;698_880del n/a
Download CSV