Transcript: Human XM_011510549.2

PREDICTED: Homo sapiens ArfGAP with GTPase domain, ankyrin repeat and PH domain 1 (AGAP1), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
AGAP1 (116987)
Length:
10984
CDS:
90..3311

Additional Resources:

NCBI RefSeq record:
XM_011510549.2
NBCI Gene record:
AGAP1 (116987)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011510549.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000281188 GTGGGAGTTTAAGCGACTATT pLKO_005 1711 CDS 100% 13.200 18.480 N AGAP1 n/a
2 TRCN0000281189 ACAGTCGAATGGCCAACTATC pLKO_005 1372 CDS 100% 10.800 15.120 N AGAP1 n/a
3 TRCN0000159943 GAGAAACAATAACCGGAACAA pLKO.1 3260 CDS 100% 4.950 6.930 N AGAP1 n/a
4 TRCN0000162145 CAGGAGAAACAATAACCGGAA pLKO.1 3257 CDS 100% 2.160 3.024 N AGAP1 n/a
5 TRCN0000166007 GCTGACCTATCATCCCAGTTT pLKO.1 2027 CDS 100% 4.950 3.960 N AGAP1 n/a
6 TRCN0000281190 CCTGCAAGTCGCTACCTAATT pLKO_005 1621 CDS 100% 13.200 9.240 N AGAP1 n/a
7 TRCN0000162669 CGAAGTGGCAAATCGTTGAAT pLKO.1 1962 CDS 100% 5.625 3.938 N AGAP1 n/a
8 TRCN0000166533 CCCAGAAGATTGTTGCCACAA pLKO.1 1573 CDS 100% 4.050 2.835 N AGAP1 n/a
9 TRCN0000158713 GAAGTGGCAAATCGTTGAATA pLKO.1 1963 CDS 100% 13.200 7.920 N AGAP1 n/a
10 TRCN0000106025 GCTGTTTAATAGAACGTGATT pLKO.1 3906 3UTR 100% 4.950 2.970 N Agap1 n/a
11 TRCN0000158851 GCTGTTTAATAGAACGTGATT pLKO.1 3906 3UTR 100% 4.950 2.970 N AGAP1 n/a
12 TRCN0000281187 GCTGTTTAATAGAACGTGATT pLKO_005 3906 3UTR 100% 4.950 2.970 N AGAP1 n/a
13 TRCN0000316909 GCTGTTTAATAGAACGTGATT pLKO_005 3906 3UTR 100% 4.950 2.970 N Agap1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011510549.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.