Transcript: Human XM_011510926.2

PREDICTED: Homo sapiens grancalcin (GCA), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GCA (25801)
Length:
1055
CDS:
186..830

Additional Resources:

NCBI RefSeq record:
XM_011510926.2
NBCI Gene record:
GCA (25801)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011510926.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000054136 GCGAATTTCATATATGACGAT pLKO.1 735 CDS 100% 2.640 3.696 N GCA n/a
2 TRCN0000291531 GCGAATTTCATATATGACGAT pLKO_005 735 CDS 100% 2.640 3.696 N GCA n/a
3 TRCN0000054133 GCCAGCATATTCAGACACTTA pLKO.1 248 CDS 100% 4.950 3.960 N GCA n/a
4 TRCN0000291530 GCCAGCATATTCAGACACTTA pLKO_005 248 CDS 100% 4.950 3.960 N GCA n/a
5 TRCN0000054134 CCATTGGTCTTATGGGTTATA pLKO.1 568 CDS 100% 13.200 9.240 N GCA n/a
6 TRCN0000291582 CCATTGGTCTTATGGGTTATA pLKO_005 568 CDS 100% 13.200 9.240 N GCA n/a
7 TRCN0000054135 CGAGCATTGACAGATTTCTTT pLKO.1 684 CDS 100% 5.625 3.938 N GCA n/a
8 TRCN0000307717 CGAGCATTGACAGATTTCTTT pLKO_005 684 CDS 100% 5.625 3.938 N GCA n/a
9 TRCN0000054137 GTCTGGAATTAATGGAACTTA pLKO.1 365 CDS 100% 5.625 3.938 N GCA n/a
10 TRCN0000291585 GTCTGGAATTAATGGAACTTA pLKO_005 365 CDS 100% 5.625 3.938 N GCA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011510926.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07945 pDONR223 100% 82.6% 81.7% None (many diffs) n/a
2 ccsbBroad304_07945 pLX_304 0% 82.6% 81.7% V5 (many diffs) n/a
3 TRCN0000471038 CGAAAGGACCTTGTTAACAGTTTA pLX_317 77.1% 82.6% 81.7% V5 (many diffs) n/a
Download CSV