Transcript: Human XM_011511443.2

PREDICTED: Homo sapiens sphingomyelin phosphodiesterase 4 (SMPD4), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SMPD4 (55627)
Length:
4067
CDS:
85..2919

Additional Resources:

NCBI RefSeq record:
XM_011511443.2
NBCI Gene record:
SMPD4 (55627)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011511443.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000245616 AGTGCCAAGACTTGGTTAAAG pLKO_005 518 CDS 100% 13.200 7.920 N SMPD4 n/a
2 TRCN0000245618 CCCTGAATCCGTTCGAGTATT pLKO_005 884 CDS 100% 13.200 7.920 N SMPD4 n/a
3 TRCN0000172804 GCAGTGCCAAGACTTGGTTAA pLKO.1 516 CDS 100% 10.800 6.480 N SMPD4 n/a
4 TRCN0000245620 CCTGAAAGCTGACTCTATAAA pLKO_005 480 CDS 100% 15.000 7.500 Y SMPD4 n/a
5 TRCN0000245617 ACTTCAGACTGTGCCTATTTC pLKO_005 970 CDS 100% 13.200 6.600 Y SMPD4 n/a
6 TRCN0000124165 GCCTGAAAGCTGACTCTATAA pLKO.1 479 CDS 100% 13.200 6.600 Y Smpd4 n/a
7 TRCN0000331603 GCCTGAAAGCTGACTCTATAA pLKO_005 479 CDS 100% 13.200 6.600 Y Smpd4 n/a
8 TRCN0000245619 GGAGTACCTGCGCCAGATATT pLKO_005 2304 CDS 100% 13.200 6.600 Y SMPD4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011511443.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12238 pDONR223 100% 77.8% 77.8% None 1_627del;1086G>A n/a
2 ccsbBroad304_12238 pLX_304 0% 77.8% 77.8% V5 1_627del;1086G>A n/a
3 TRCN0000477592 CCTTTCAAACCCGATGTTAGGCCA pLX_317 5% 77.8% 77.8% V5 1_627del;1086G>A n/a
Download CSV