Transcript: Human XM_011511486.3

PREDICTED: Homo sapiens cripto, FRL-1, cryptic family 1 (CFC1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CFC1 (55997)
Length:
932
CDS:
284..712

Additional Resources:

NCBI RefSeq record:
XM_011511486.3
NBCI Gene record:
CFC1 (55997)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011511486.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000262300 GGCATTACAGATCATCAATTT pLKO_005 328 CDS 100% 13.200 6.600 Y CFC1B n/a
2 TRCN0000426964 TTTGGGAAACAGCTATCAAAG pLKO_005 346 CDS 100% 10.800 5.400 Y CFC1 n/a
3 TRCN0000262302 CACCAAGGTTGCCACTCAGAA pLKO_005 397 CDS 100% 4.950 2.475 Y CFC1B n/a
4 TRCN0000118105 ACAGATCATCAATTTGGGAAA pLKO.1 334 CDS 100% 4.050 2.025 Y CFC1 n/a
5 TRCN0000426028 ACCAAGGTTGCCACTCAGAAG pLKO_005 398 CDS 100% 4.050 2.025 Y CFC1 n/a
6 TRCN0000262301 GAGAAACATAACGGCGGTAGA pLKO_005 368 CDS 100% 4.050 2.025 Y CFC1B n/a
7 TRCN0000282175 GTCATTTCGGAGAGGTGACTG pLKO_005 450 CDS 100% 4.050 2.025 Y CFC1B n/a
8 TRCN0000118102 GTTTACGGTCAGTTTGGCATT pLKO.1 313 CDS 100% 4.050 2.025 Y CFC1 n/a
9 TRCN0000118103 GAGAGAAACATAACGGCGGTA pLKO.1 366 CDS 100% 2.160 1.080 Y CFC1 n/a
10 TRCN0000118104 CAACTGGACCTCCAGTCATTT pLKO.1 436 CDS 100% 1.320 0.660 Y CFC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011511486.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03692 pDONR223 100% 47.2% 34.2% None (many diffs) n/a
2 ccsbBroad304_03692 pLX_304 0% 47.2% 34.2% V5 (many diffs) n/a
Download CSV