Transcript: Human XM_011511655.2

PREDICTED: Homo sapiens cyclin dependent kinase 15 (CDK15), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CDK15 (65061)
Length:
3680
CDS:
634..1401

Additional Resources:

NCBI RefSeq record:
XM_011511655.2
NBCI Gene record:
CDK15 (65061)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001144734 TGGATGCTGAGACATATACT pXPR_003 GGG 22 3% 3 1.0646 CDK15 CDK15 76486
2 BRDN0001145059 GGCTCCCAGCAAAGCATCAG pXPR_003 GGG 265 35% 5 0.145 CDK15 CDK15 76483
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011511655.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000196597 GAAGCACTTGTTCATGATTAT pLKO.1 1231 CDS 100% 13.200 9.240 N CDK15 n/a
2 TRCN0000199747 GAGGGCTTCATCCTCATAATG pLKO.1 674 CDS 100% 13.200 9.240 N CDK15 n/a
3 TRCN0000196498 GCTTACTAAGAAGCTTCAAAT pLKO.1 1472 3UTR 100% 13.200 9.240 N CDK15 n/a
4 TRCN0000199688 GTTTCAGGAGTGAGGCTAAAG pLKO.1 1309 CDS 100% 10.800 7.560 N CDK15 n/a
5 TRCN0000002099 CAAATCTAACTCCATACTGAA pLKO.1 1488 3UTR 100% 4.950 3.465 N CDK15 n/a
6 TRCN0000002096 CACCAAAGAGACACTGACATT pLKO.1 600 5UTR 100% 4.950 3.465 N CDK15 n/a
7 TRCN0000002097 CTACCTAACTACAATCCAGAA pLKO.1 1084 CDS 100% 4.050 2.835 N CDK15 n/a
8 TRCN0000199929 GCCACTGAATATTCCTCTGAG pLKO.1 913 CDS 100% 4.050 2.835 N CDK15 n/a
9 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2208 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011511655.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12510 pDONR223 100% 57.2% 57.2% None 0_1ins387;661_765del n/a
2 ccsbBroad304_12510 pLX_304 0% 57.2% 57.2% V5 0_1ins387;661_765del n/a
3 TRCN0000467466 AAAGGGTTGCCTAGCCCCCAAGGT pLX_317 7.9% 57.2% 57.2% V5 0_1ins387;661_765del n/a
4 ccsbBroadEn_15139 pDONR223 0% 57.2% 57.2% None 0_1ins387;661_765del n/a
5 ccsbBroad304_15139 pLX_304 0% 57.2% 57.2% V5 0_1ins387;661_765del n/a
6 TRCN0000480211 AGCAATTCTAAGCAATCTCCAACG pLX_317 35.3% 57.2% 57.2% V5 0_1ins387;661_765del n/a
Download CSV