Transcript: Human XM_011511662.2

PREDICTED: Homo sapiens neurobeachin like 1 (NBEAL1), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NBEAL1 (65065)
Length:
7263
CDS:
76..7239

Additional Resources:

NCBI RefSeq record:
XM_011511662.2
NBCI Gene record:
NBEAL1 (65065)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011511662.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000262291 AGGGATGGAACGGTGATTATA pLKO_005 6649 CDS 100% 15.000 21.000 N NBEAL1 n/a
2 TRCN0000157787 CGACTGCCTATCCATTGTGTT pLKO.1 6994 CDS 100% 4.950 6.930 N NBEAL1 n/a
3 TRCN0000262290 AGACTCAAACACACCATTATT pLKO_005 3126 CDS 100% 15.000 10.500 N NBEAL1 n/a
4 TRCN0000249521 ATGGCAGGACGAACCTATAAT pLKO_005 5185 CDS 100% 15.000 10.500 N Nbeal1 n/a
5 TRCN0000282182 ATGGCAGGACGAACCTATAAT pLKO_005 5185 CDS 100% 15.000 10.500 N NBEAL1 n/a
6 TRCN0000262293 CAAACACCCTGTCAATTATTA pLKO_005 5926 CDS 100% 15.000 10.500 N NBEAL1 n/a
7 TRCN0000152932 CGGAAGAGTTGGACCTTAATA pLKO.1 5255 CDS 100% 15.000 10.500 N NBEAL1 n/a
8 TRCN0000249525 GTGATGGTATTCCACTATTAA pLKO_005 6074 CDS 100% 15.000 10.500 N Nbeal1 n/a
9 TRCN0000262294 AGATCACCACAGGAGTTATTC pLKO_005 5089 CDS 100% 13.200 9.240 N NBEAL1 n/a
10 TRCN0000262289 CAGACTGAAATCTACTCATTT pLKO_005 4000 CDS 100% 13.200 9.240 N NBEAL1 n/a
11 TRCN0000262288 GAGATCACTTCTAAGCTATTT pLKO_005 6307 CDS 100% 13.200 9.240 N NBEAL1 n/a
12 TRCN0000262295 TCGGAAGAGTTGGACCTTAAT pLKO_005 5254 CDS 100% 13.200 9.240 N NBEAL1 n/a
13 TRCN0000150906 GCTACAGATTACTGTGGAATA pLKO.1 6457 CDS 100% 10.800 7.560 N NBEAL1 n/a
14 TRCN0000157473 GCCGACTGTTGTCACTTCATT pLKO.1 5045 CDS 100% 5.625 3.938 N NBEAL1 n/a
15 TRCN0000150393 CATACAAGGATTCCTGTCTAT pLKO.1 6927 CDS 100% 4.950 3.465 N NBEAL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011511662.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.