Transcript: Human XM_011512006.2

PREDICTED: Homo sapiens major facilitator superfamily domain containing 9 (MFSD9), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MFSD9 (84804)
Length:
5237
CDS:
394..1443

Additional Resources:

NCBI RefSeq record:
XM_011512006.2
NBCI Gene record:
MFSD9 (84804)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011512006.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000005747 GCCGCTTGTAATCGGACACTT pLKO.1 513 CDS 100% 4.950 6.930 N MFSD9 n/a
2 TRCN0000434739 GTCATGCTGTACTACAGTAAC pLKO_005 913 CDS 100% 10.800 8.640 N MFSD9 n/a
3 TRCN0000005745 GCTGGTCTCGTTTGGTTCTTT pLKO.1 652 CDS 100% 5.625 4.500 N MFSD9 n/a
4 TRCN0000005746 CTAGTGGTGATGGGAATAGTA pLKO.1 1406 CDS 100% 0.000 0.000 N MFSD9 n/a
5 TRCN0000433033 ACTTGAGTTTCCAGTTAAATT pLKO_005 1883 3UTR 100% 15.000 10.500 N MFSD9 n/a
6 TRCN0000417729 TCCGAAATGTGGGACATATTT pLKO_005 865 CDS 100% 15.000 10.500 N MFSD9 n/a
7 TRCN0000425727 GATGGATTTGGACAACATAAA pLKO_005 1443 CDS 100% 13.200 9.240 N MFSD9 n/a
8 TRCN0000424942 GTGGCTATCTCACTGAATTAG pLKO_005 578 CDS 100% 13.200 9.240 N MFSD9 n/a
9 TRCN0000413989 GTGAGCATATTCAGCGTTTAC pLKO_005 1674 3UTR 100% 10.800 7.560 N MFSD9 n/a
10 TRCN0000420031 TGTTAGCCTTAGTGGCCATTT pLKO_005 1358 CDS 100% 10.800 7.560 N MFSD9 n/a
11 TRCN0000101988 CATGCTGTACTACAGTAACTT pLKO.1 915 CDS 100% 5.625 3.938 N Mfsd9 n/a
12 TRCN0000005744 GCCAAGAAATCCGTGGTGTTT pLKO.1 2047 3UTR 100% 4.950 3.465 N MFSD9 n/a
13 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 2551 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011512006.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09224 pDONR223 98.8% 72.6% 69.2% None (many diffs) n/a
2 ccsbBroad304_09224 pLX_304 0% 72.6% 69.2% V5 (many diffs) n/a
Download CSV