Transcript: Human XM_011512369.3

PREDICTED: Homo sapiens programmed cell death 10 (PDCD10), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PDCD10 (11235)
Length:
2384
CDS:
1332..1970

Additional Resources:

NCBI RefSeq record:
XM_011512369.3
NBCI Gene record:
PDCD10 (11235)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011512369.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000140317 CGTAAGTGCCAACCGACTAAT pLKO.1 1904 CDS 100% 13.200 18.480 N PDCD10 n/a
2 TRCN0000247096 TAATGAGCTAGAACGAGTAAA pLKO_005 1421 CDS 100% 13.200 18.480 N Pdcd10 n/a
3 TRCN0000145305 CAAGGATATAGCTAGTGCAAT pLKO.1 1724 CDS 100% 4.950 6.930 N PDCD10 n/a
4 TRCN0000144468 CCAACTTAATACTTCAGACCT pLKO.1 1933 CDS 100% 2.640 3.696 N PDCD10 n/a
5 TRCN0000139464 CCGCTTTCATCAAGGCTGAAA pLKO.1 1468 CDS 100% 0.495 0.693 N PDCD10 n/a
6 TRCN0000435284 ACGGAGTCCCTTCTTCGTATG pLKO_005 1560 CDS 100% 6.000 4.800 N PDCD10 n/a
7 TRCN0000144228 CAGGATGTTGAATGGGATTAT pLKO.1 2084 3UTR 100% 13.200 9.240 N PDCD10 n/a
8 TRCN0000182961 CAGTCATGTATCCTGTGTTTA pLKO.1 1402 CDS 100% 13.200 9.240 N Pdcd10 n/a
9 TRCN0000141584 CCAGGATGTTGAATGGGATTA pLKO.1 2083 3UTR 100% 10.800 7.560 N PDCD10 n/a
10 TRCN0000122250 CCTGTGTTTAATGAGCTAGAA pLKO.1 1413 CDS 100% 4.950 3.465 N PDCD10 n/a
11 TRCN0000144821 GAATGGGATTATTGCCATCTT pLKO.1 2093 3UTR 100% 4.950 3.465 N PDCD10 n/a
12 TRCN0000122022 GCTGATGATGTAGAAGAGTAT pLKO.1 1584 CDS 100% 4.950 3.465 N PDCD10 n/a
13 TRCN0000142703 CCAGATGAGATCAATGACAGA pLKO.1 1683 CDS 100% 2.640 1.848 N PDCD10 n/a
14 TRCN0000141939 GATCAATGACAGAGTGAGGTT pLKO.1 1691 CDS 100% 2.640 1.848 N PDCD10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011512369.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02654 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02654 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000474286 GCCTCAAACTTCACCCGTCTTGTG pLX_317 62.3% 100% 100% V5 n/a
Download CSV