Transcript: Human XM_011512447.3

PREDICTED: Homo sapiens B and T lymphocyte associated (BTLA), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
BTLA (151888)
Length:
4264
CDS:
299..1186

Additional Resources:

NCBI RefSeq record:
XM_011512447.3
NBCI Gene record:
BTLA (151888)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011512447.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000435139 CAGAATAGTAGAACGTTTAAA pLKO_005 1438 3UTR 100% 15.000 21.000 N BTLA n/a
2 TRCN0000435951 TCATACCGCTGTTCTGCAAAT pLKO_005 632 CDS 100% 10.800 15.120 N BTLA n/a
3 TRCN0000149495 GAACTAGAATGCCCTGTGAAA pLKO.1 461 CDS 100% 4.950 6.930 N BTLA n/a
4 TRCN0000148370 CACAGCAGGAAGGGAAATTAA pLKO.1 886 CDS 100% 15.000 12.000 N BTLA n/a
5 TRCN0000413967 TTTGACTAACCAACCATAAAT pLKO_005 1588 3UTR 100% 15.000 10.500 N BTLA n/a
6 TRCN0000422741 TGTTAGTGCTTGGGTCTTAAG pLKO_005 1307 3UTR 100% 10.800 7.560 N BTLA n/a
7 TRCN0000183326 GAGATCCCTTTGAACTAGAAT pLKO.1 450 CDS 100% 5.625 3.938 N BTLA n/a
8 TRCN0000147179 CATGGGAAAGAATCATGTGAT pLKO.1 383 CDS 100% 4.950 3.465 N BTLA n/a
9 TRCN0000149125 GATTGCCTCTACTCATCACTA pLKO.1 804 CDS 100% 4.950 3.465 N BTLA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011512447.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09681 pDONR223 100% 81.5% 81.3% None 402_563del;818C>T n/a
2 ccsbBroad304_09681 pLX_304 0% 81.5% 81.3% V5 402_563del;818C>T n/a
3 TRCN0000472303 CAGCCGAGGTCGAGTGATCTGGTA pLX_317 62.8% 81.5% 81.3% V5 402_563del;818C>T n/a
Download CSV