Transcript: Human XM_011512558.3

PREDICTED: Homo sapiens nuclear cap binding protein subunit 2 (NCBP2), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NCBP2 (22916)
Length:
4873
CDS:
331..591

Additional Resources:

NCBI RefSeq record:
XM_011512558.3
NBCI Gene record:
NCBP2 (22916)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011512558.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000303608 TTGCATGAGATAGCCTAATAA pLKO_005 996 3UTR 100% 15.000 21.000 N NCBP2 n/a
2 TRCN0000303541 ACGCCATGCGGTACATAAATG pLKO_005 407 CDS 100% 13.200 18.480 N NCBP2 n/a
3 TRCN0000059995 GAATATTACTCACGCGCAGAT pLKO.1 379 CDS 100% 4.050 5.670 N NCBP2 n/a
4 TRCN0000059993 GCTGTACGTTATATGTTGGAA pLKO.1 236 5UTR 100% 3.000 4.200 N NCBP2 n/a
5 TRCN0000303543 AGACTGGGACGCAGGCTTTAA pLKO_005 459 CDS 100% 13.200 9.240 N NCBP2 n/a
6 TRCN0000303544 ATCATTATGGGTCTGGATAAA pLKO_005 325 5UTR 100% 13.200 9.240 N NCBP2 n/a
7 TRCN0000059996 CGTCTGGATGACCGAATCATT pLKO.1 433 CDS 100% 5.625 3.938 N NCBP2 n/a
8 TRCN0000059997 ATCTATGAACTCTTCAGCAAA pLKO.1 286 5UTR 100% 4.950 3.465 N NCBP2 n/a
9 TRCN0000059994 GTGACAATGAAGAACAAGAAA pLKO.1 200 5UTR 100% 5.625 3.375 N NCBP2 n/a
10 TRCN0000299252 GTGACAATGAAGAACAAGAAA pLKO_005 200 5UTR 100% 5.625 3.375 N NCBP2 n/a
11 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 4306 3UTR 100% 4.950 2.475 Y ERAP2 n/a
12 TRCN0000140719 GATCACTTGAGGTCAGGAGTT pLKO.1 4345 3UTR 100% 4.050 2.025 Y P3H4 n/a
13 TRCN0000165299 GATCACTTGAGGTCAGGAGTT pLKO.1 4345 3UTR 100% 4.050 2.025 Y ORAI2 n/a
14 TRCN0000352971 GATCACTTGAGGTCAGGAGTT pLKO_005 4345 3UTR 100% 4.050 2.025 Y P3H4 n/a
15 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 3721 3UTR 100% 13.200 6.600 Y LIAS n/a
16 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 4473 3UTR 100% 4.950 2.475 Y DCAF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011512558.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.