Transcript: Human XM_011512586.2

PREDICTED: Homo sapiens MCF.2 cell line derived transforming sequence-like 2 (MCF2L2), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MCF2L2 (23101)
Length:
5752
CDS:
203..2488

Additional Resources:

NCBI RefSeq record:
XM_011512586.2
NBCI Gene record:
MCF2L2 (23101)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011512586.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000047575 CCAGGGATTATCTCCTCATTA pLKO.1 1813 CDS 100% 13.200 10.560 N MCF2L2 n/a
2 TRCN0000413330 ATTCACAAGGATCGTTATAAA pLKO_005 1697 CDS 100% 15.000 10.500 N MCF2L2 n/a
3 TRCN0000047574 GCTCATCCAAAGCCACCATTA pLKO.1 301 CDS 100% 10.800 7.560 N MCF2L2 n/a
4 TRCN0000047577 CGAATTTCACAACAGGACTTT pLKO.1 1174 CDS 100% 4.950 3.465 N MCF2L2 n/a
5 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3641 3UTR 100% 5.625 2.813 Y KLHL30 n/a
6 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3641 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011512586.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11675 pDONR223 100% 31.9% 31.5% None (many diffs) n/a
2 ccsbBroad304_11675 pLX_304 0% 31.9% 31.5% V5 (many diffs) n/a
3 TRCN0000476383 AATCGAACAGTCTTACTCGTTTCG pLX_317 18.7% 31.9% 31.5% V5 (many diffs) n/a
Download CSV