Transcript: Human XM_011512627.3

PREDICTED: Homo sapiens germinal center associated signaling and motility (GCSAM), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GCSAM (257144)
Length:
3996
CDS:
837..1382

Additional Resources:

NCBI RefSeq record:
XM_011512627.3
NBCI Gene record:
GCSAM (257144)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011512627.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000414849 AGCTTTACTCATCATACTAAG pLKO_005 1756 3UTR 100% 10.800 15.120 N GCSAM n/a
2 TRCN0000129677 CACTTCTACATATGCCTTCTA pLKO.1 1231 CDS 100% 0.000 0.000 N GCSAM n/a
3 TRCN0000414554 TGTCTGGGATCTTCTTATAAA pLKO_005 1701 3UTR 100% 15.000 10.500 N GCSAM n/a
4 TRCN0000149308 GAGGAACTGAGACTGAGTATT pLKO.1 1210 CDS 100% 13.200 9.240 N GCSAM n/a
5 TRCN0000129321 CAGATGCTGGGATCACCATAT pLKO.1 938 CDS 100% 10.800 7.560 N GCSAM n/a
6 TRCN0000130171 CACAGAATCTCCTCTCACTTT pLKO.1 1305 CDS 100% 4.950 3.465 N GCSAM n/a
7 TRCN0000147441 GAGACTGAGTATTCACTTCTA pLKO.1 1218 CDS 100% 4.950 3.465 N GCSAM n/a
8 TRCN0000424158 GCTATACCCTCATCAATCATC pLKO_005 1099 CDS 100% 4.950 3.465 N GCSAM n/a
9 TRCN0000130296 CTATGAGAATGTTCCCTGCAA pLKO.1 1163 CDS 100% 2.640 1.848 N GCSAM n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011512627.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09920 pDONR223 100% 98.1% 97.7% None 13C>G;27_32delCAGTTT;223_225delCAG n/a
2 ccsbBroad304_09920 pLX_304 0% 98.1% 97.7% V5 13C>G;27_32delCAGTTT;223_225delCAG n/a
3 TRCN0000468449 GACCCTACTTGATAGCTATCTTAC pLX_317 33.7% 98.1% 97.7% V5 13C>G;27_32delCAGTTT;223_225delCAG n/a
Download CSV