Transcript: Human XM_011512629.2

PREDICTED: Homo sapiens germinal center associated signaling and motility (GCSAM), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GCSAM (257144)
Length:
4445
CDS:
1343..1831

Additional Resources:

NCBI RefSeq record:
XM_011512629.2
NBCI Gene record:
GCSAM (257144)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011512629.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000414849 AGCTTTACTCATCATACTAAG pLKO_005 2205 3UTR 100% 10.800 15.120 N GCSAM n/a
2 TRCN0000129677 CACTTCTACATATGCCTTCTA pLKO.1 1680 CDS 100% 0.000 0.000 N GCSAM n/a
3 TRCN0000414554 TGTCTGGGATCTTCTTATAAA pLKO_005 2150 3UTR 100% 15.000 10.500 N GCSAM n/a
4 TRCN0000149308 GAGGAACTGAGACTGAGTATT pLKO.1 1659 CDS 100% 13.200 9.240 N GCSAM n/a
5 TRCN0000129321 CAGATGCTGGGATCACCATAT pLKO.1 1387 CDS 100% 10.800 7.560 N GCSAM n/a
6 TRCN0000130171 CACAGAATCTCCTCTCACTTT pLKO.1 1754 CDS 100% 4.950 3.465 N GCSAM n/a
7 TRCN0000147441 GAGACTGAGTATTCACTTCTA pLKO.1 1667 CDS 100% 4.950 3.465 N GCSAM n/a
8 TRCN0000424158 GCTATACCCTCATCAATCATC pLKO_005 1548 CDS 100% 4.950 3.465 N GCSAM n/a
9 TRCN0000130296 CTATGAGAATGTTCCCTGCAA pLKO.1 1612 CDS 100% 2.640 1.848 N GCSAM n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011512629.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09920 pDONR223 100% 89.9% 89.9% None 0_1ins51;166_168delCAG n/a
2 ccsbBroad304_09920 pLX_304 0% 89.9% 89.9% V5 0_1ins51;166_168delCAG n/a
3 TRCN0000468449 GACCCTACTTGATAGCTATCTTAC pLX_317 33.7% 89.9% 89.9% V5 0_1ins51;166_168delCAG n/a
Download CSV