Transcript: Human XM_011512675.3

PREDICTED: Homo sapiens SEC22 homolog A, vesicle trafficking protein (SEC22A), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SEC22A (26984)
Length:
1977
CDS:
247..1170

Additional Resources:

NCBI RefSeq record:
XM_011512675.3
NBCI Gene record:
SEC22A (26984)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011512675.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000340437 GAGGACCAAGCAGCGATATAA pLKO_005 606 CDS 100% 15.000 21.000 N Sec22a n/a
2 TRCN0000380014 GAGGACCAAGCAGCGATATAA pLKO_005 606 CDS 100% 15.000 21.000 N SEC22A n/a
3 TRCN0000059545 GCTGGCGGAATGTCAAATCTT pLKO.1 995 CDS 100% 5.625 7.875 N SEC22A n/a
4 TRCN0000059547 GCTTCTACTGATTATGAACAA pLKO.1 304 CDS 100% 4.950 6.930 N SEC22A n/a
5 TRCN0000340360 GGAGTTCATTACTACTTATAA pLKO_005 522 CDS 100% 15.000 10.500 N Sec22a n/a
6 TRCN0000059544 GCAGGAGTGCAGAAAGTATTT pLKO.1 336 CDS 100% 13.200 9.240 N SEC22A n/a
7 TRCN0000380955 TCTGACATGCAGACGGAAATC pLKO_005 661 CDS 100% 10.800 7.560 N SEC22A n/a
8 TRCN0000059543 CCAGTGTTATTTACTTGTCTA pLKO.1 966 CDS 100% 4.950 3.465 N SEC22A n/a
9 TRCN0000059546 CTGAATTTAATTCGAGGCTTT pLKO.1 859 CDS 100% 4.050 2.835 N SEC22A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011512675.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02977 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02977 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000472851 TGAATTCGCAGAGGGAAGGGCCGT pLX_317 36% 100% 100% V5 n/a
Download CSV