Transcript: Human XM_011513074.1

PREDICTED: Homo sapiens autophagy related 3 (ATG3), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ATG3 (64422)
Length:
1179
CDS:
307..990

Additional Resources:

NCBI RefSeq record:
XM_011513074.1
NBCI Gene record:
ATG3 (64422)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011513074.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000149597 CCTACCAACAGGCAAACAATT pLKO.1 243 5UTR 100% 13.200 10.560 N ATG3 n/a
2 TRCN0000278562 CCTACCAACAGGCAAACAATT pLKO_005 243 5UTR 100% 13.200 10.560 N ATG3 n/a
3 TRCN0000216112 CAAGCTGTCATTCCAACAATA pLKO.1 937 CDS 100% 13.200 9.240 N Atg3 n/a
4 TRCN0000215808 CATATCACAACACAGGTATTA pLKO.1 374 CDS 100% 13.200 9.240 N Atg3 n/a
5 TRCN0000247440 CATATCACAACACAGGTATTA pLKO_005 374 CDS 100% 13.200 9.240 N Atg3 n/a
6 TRCN0000148120 GATGTGACCATTGACCATATT pLKO.1 1051 3UTR 100% 13.200 9.240 N ATG3 n/a
7 TRCN0000146846 CCAGAACTTATGACCTTTACA pLKO.1 635 CDS 100% 5.625 3.938 N ATG3 n/a
8 TRCN0000278507 CCAGAACTTATGACCTTTACA pLKO_005 635 CDS 100% 5.625 3.938 N ATG3 n/a
9 TRCN0000147381 GCTGTCATTCCAACAATAGAA pLKO.1 940 CDS 100% 5.625 3.938 N ATG3 n/a
10 TRCN0000278506 GCTGTCATTCCAACAATAGAA pLKO_005 940 CDS 100% 5.625 3.938 N ATG3 n/a
11 TRCN0000149642 GACTCCACGATTATGGTTGTT pLKO.1 678 CDS 100% 4.950 3.465 N ATG3 n/a
12 TRCN0000278505 GACTCCACGATTATGGTTGTT pLKO_005 678 CDS 100% 4.950 3.465 N ATG3 n/a
13 TRCN0000247441 TGTGACCATTGACCATATTTA pLKO_005 1053 3UTR 100% 15.000 9.000 N Atg3 n/a
14 TRCN0000018931 GAAGAAGATGAAGATGAAGAA pLKO.1 481 CDS 100% 4.950 2.475 Y HMGB1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011513074.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03950 pDONR223 100% 72.2% 72.2% None 0_1ins261 n/a
2 ccsbBroad304_03950 pLX_304 0% 72.2% 72.2% V5 0_1ins261 n/a
3 TRCN0000469229 ACTGCAGCGCCGCATAGACTTTGA pLX_317 43.8% 72.2% 72.2% V5 0_1ins261 n/a
Download CSV