Transcript: Human XM_011513228.2

PREDICTED: Homo sapiens UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 5 (B3GNT5), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
B3GNT5 (84002)
Length:
4174
CDS:
582..1718

Additional Resources:

NCBI RefSeq record:
XM_011513228.2
NBCI Gene record:
B3GNT5 (84002)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011513228.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000417406 ATGATCGACGTTCCGGAATTA pLKO_005 883 CDS 100% 13.200 18.480 N B3GNT5 n/a
2 TRCN0000034811 CTTTGGAAGAATGCTACAGAT pLKO.1 1575 CDS 100% 4.950 6.930 N B3GNT5 n/a
3 TRCN0000034812 CCAATACTTGATTAACCACAA pLKO.1 800 CDS 100% 4.050 5.670 N B3GNT5 n/a
4 TRCN0000034809 GCCTATGTAATCTCCGGTGAT pLKO.1 1350 CDS 100% 4.050 5.670 N B3GNT5 n/a
5 TRCN0000424495 TGAACGTACAGTACAACATTT pLKO_005 2068 3UTR 100% 13.200 9.240 N B3GNT5 n/a
6 TRCN0000034810 CCTCGCTACCAATACTTGATT pLKO.1 792 CDS 100% 5.625 3.938 N B3GNT5 n/a
7 TRCN0000034813 AGCAAATACTACGTGTCCTAT pLKO.1 1284 CDS 100% 4.950 2.970 N B3GNT5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011513228.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04316 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04316 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000472906 ACTGTACGCAAGCCAGGCGCTGTG pLX_317 40% 100% 100% V5 n/a
Download CSV