Transcript: Human XM_011513407.2

PREDICTED: Homo sapiens tRNA methyltransferase 44 homolog (TRMT44), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TRMT44 (152992)
Length:
3117
CDS:
48..2189

Additional Resources:

NCBI RefSeq record:
XM_011513407.2
NBCI Gene record:
TRMT44 (152992)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011513407.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000162569 CACCCAATGATAAGACCCTTT pLKO.1 1264 CDS 100% 4.050 5.670 N TRMT44 n/a
2 TRCN0000160577 CGAATTTACTGTTAGGTGGAA pLKO.1 1897 CDS 100% 2.640 3.696 N TRMT44 n/a
3 TRCN0000160247 CCCTGATGTTGATTGGTTAAT pLKO.1 1286 CDS 100% 13.200 9.240 N TRMT44 n/a
4 TRCN0000160459 CGCAGCATCTTCATATCATAA pLKO.1 2805 3UTR 100% 13.200 9.240 N TRMT44 n/a
5 TRCN0000158943 GCAGCATCTTCATATCATAAA pLKO.1 2806 3UTR 100% 13.200 9.240 N TRMT44 n/a
6 TRCN0000135175 CGGGAATACCTTGACTTCATT pLKO.1 1452 CDS 100% 5.625 3.938 N TRMT44 n/a
7 TRCN0000164446 CCGGGAATACCTTGACTTCAT pLKO.1 1451 CDS 100% 4.950 3.465 N TRMT44 n/a
8 TRCN0000164481 CCTGGATTTCATCCCAGAGAA pLKO.1 1806 CDS 100% 4.950 3.465 N TRMT44 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011513407.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13289 pDONR223 100% 57.4% 55.2% None (many diffs) n/a
2 ccsbBroad304_13289 pLX_304 0% 57.4% 55.2% V5 (many diffs) n/a
3 TRCN0000472004 CAAATACTCACATGGACCTTTTTA pLX_317 39.7% 57.4% 55.2% V5 (many diffs) n/a
Download CSV