Transcript: Human XM_011513692.1

PREDICTED: Homo sapiens ras homolog family member H (RHOH), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RHOH (399)
Length:
1983
CDS:
714..1289

Additional Resources:

NCBI RefSeq record:
XM_011513692.1
NBCI Gene record:
RHOH (399)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011513692.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000047821 CCGGCAATGACGCCTTCAGAA pLKO.1 892 CDS 100% 1.650 2.310 N RHOH n/a
2 TRCN0000047818 CCATAACTCATTCCTGAACTT pLKO.1 974 CDS 100% 4.950 3.960 N RHOH n/a
3 TRCN0000047820 ACAAGTGGATTGGTGAAATTA pLKO.1 1000 CDS 100% 15.000 10.500 N RHOH n/a
4 TRCN0000438734 AGCCCACAGTGTACGAGAACA pLKO_005 814 CDS 100% 4.950 3.465 N RHOH n/a
5 TRCN0000445349 GAGTGCTCAGCCCTTAGCAAT pLKO_005 1161 CDS 100% 4.950 3.465 N RHOH n/a
6 TRCN0000047822 ACGAAACAGAAGGAGGCTCTT pLKO.1 1241 CDS 100% 4.050 2.835 N RHOH n/a
7 TRCN0000047819 CTTCTCCATCAATGAGTGCAA pLKO.1 1259 CDS 100% 2.640 1.848 N RHOH n/a
8 TRCN0000431657 GAGACTTCACACAACACTTAT pLKO_005 1297 3UTR 100% 13.200 7.920 N RHOH n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011513692.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00103 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00103 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000470219 ATGGTTGTCCGTTCGGTAATTCTG pLX_317 85.8% 100% 100% V5 n/a
Download CSV