Transcript: Human XM_011513779.2

PREDICTED: Homo sapiens cytoplasmic polyadenylation element binding protein 2 (CPEB2), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CPEB2 (132864)
Length:
3411
CDS:
249..2249

Additional Resources:

NCBI RefSeq record:
XM_011513779.2
NBCI Gene record:
CPEB2 (132864)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011513779.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000232778 GTCATAGCACCACCGAAATTT pLKO_005 2079 CDS 100% 15.000 21.000 N CPEB2 n/a
2 TRCN0000150178 GTGTTCAGAACAGACAACAAT pLKO.1 2148 CDS 100% 5.625 3.938 N CPEB2 n/a
3 TRCN0000232777 GCAGCAGAGGAACTCCTATAA pLKO_005 1880 CDS 100% 13.200 7.920 N CPEB2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011513779.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13173 pDONR223 100% 20.1% 18.8% None (many diffs) n/a
2 ccsbBroad304_13173 pLX_304 0% 20.1% 18.8% V5 (many diffs) n/a
3 TRCN0000477873 CAGCACTTATTCCGCAATTATGCG pLX_317 21% 20.1% 18.8% V5 (many diffs) n/a
Download CSV