Transcript: Human XM_011513850.2

PREDICTED: Homo sapiens leucine rich repeat LGI family member 2 (LGI2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LGI2 (55203)
Length:
3060
CDS:
2..997

Additional Resources:

NCBI RefSeq record:
XM_011513850.2
NBCI Gene record:
LGI2 (55203)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011513850.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000139471 CAGCTGTACCAAGGAGTCTAT pLKO.1 121 CDS 100% 4.950 3.960 N LGI2 n/a
2 TRCN0000144559 GACTCTCTGATTGAACTAGAT pLKO.1 470 CDS 100% 4.950 3.960 N LGI2 n/a
3 TRCN0000138972 CCGTTTCTGATGTGCTGTGTA pLKO.1 564 CDS 100% 4.950 3.465 N LGI2 n/a
4 TRCN0000145222 GAAATGAATTTCCGGAGCTAT pLKO.1 788 CDS 100% 4.950 3.465 N LGI2 n/a
5 TRCN0000177840 CCTGTTCATTGAAGGGAACAA pLKO.1 340 CDS 100% 0.495 0.347 N Lgi2 n/a
6 TRCN0000166364 CACACACACACACACACACAA pLKO.1 1028 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011513850.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08490 pDONR223 100% 57.5% 48.2% None (many diffs) n/a
2 ccsbBroad304_08490 pLX_304 0% 57.5% 48.2% V5 (many diffs) n/a
3 TRCN0000481617 CACACCCCACCATCCCGGGATTTC pLX_317 27.3% 57.5% 48.2% V5 (many diffs) n/a
Download CSV