Transcript: Human XM_011514038.3

PREDICTED: Homo sapiens chromosome 5 open reading frame 34 (C5orf34), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
C5orf34 (375444)
Length:
4346
CDS:
380..2089

Additional Resources:

NCBI RefSeq record:
XM_011514038.3
NBCI Gene record:
C5orf34 (375444)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011514038.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000129656 CATCTTTAGATGGTCATGCAT pLKO.1 756 CDS 100% 3.000 4.200 N C5orf34 n/a
2 TRCN0000423429 TGGTATCCTAAACCAGATTTC pLKO_005 3953 3UTR 100% 10.800 8.640 N C5orf34 n/a
3 TRCN0000146657 CCTGGGATAAATGATAGCAAT pLKO.1 1697 CDS 100% 4.950 3.960 N C5orf34 n/a
4 TRCN0000147771 GATGGACAAGAGCAGTTAATT pLKO.1 1910 CDS 100% 15.000 10.500 N C5orf34 n/a
5 TRCN0000434524 AGAAGATGAGTTGTGTAAATG pLKO_005 1008 CDS 100% 13.200 9.240 N C5orf34 n/a
6 TRCN0000428142 GGCATTACTCTAACCCTAAAT pLKO_005 1811 CDS 100% 13.200 9.240 N C5orf34 n/a
7 TRCN0000413036 TGATTCAGTACAAGTACAATA pLKO_005 415 CDS 100% 13.200 9.240 N C5orf34 n/a
8 TRCN0000422060 TTTGTCTTTAGCACTTCATTT pLKO_005 1141 CDS 100% 13.200 9.240 N C5orf34 n/a
9 TRCN0000425382 ATTGAACACCCTGAACCATAT pLKO_005 1934 CDS 100% 10.800 7.560 N C5orf34 n/a
10 TRCN0000447473 CAGAGAGATGCCCACTCATTC pLKO_005 2011 CDS 100% 10.800 7.560 N C5orf34 n/a
11 TRCN0000149513 GCCTACTCTGATGACAAAGTA pLKO.1 1772 CDS 100% 5.625 3.938 N C5orf34 n/a
12 TRCN0000146578 CACGATATTGACTGTCTTCTA pLKO.1 4095 3UTR 100% 4.950 3.465 N C5orf34 n/a
13 TRCN0000130044 GAAACCATCATACCTTCTGAA pLKO.1 635 CDS 100% 4.950 3.465 N C5orf34 n/a
14 TRCN0000150206 GCACATATAACTCAGAGTAGA pLKO.1 1196 CDS 100% 4.950 3.465 N C5orf34 n/a
15 TRCN0000147494 GTTGTTTCAAGTGACTGGTAT pLKO.1 4174 3UTR 100% 4.950 3.465 N C5orf34 n/a
16 TRCN0000148489 CCAGTCTTGATACAGATGGTA pLKO.1 699 CDS 100% 3.000 2.100 N C5orf34 n/a
17 TRCN0000147069 CCTTTAGAACAACCAGAAAGA pLKO.1 515 CDS 100% 4.950 2.970 N C5orf34 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011514038.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10071 pDONR223 100% 88.3% 87.1% None (many diffs) n/a
2 ccsbBroad304_10071 pLX_304 0% 88.3% 87.1% V5 (many diffs) n/a
3 TRCN0000473101 CGGACAAGGGTAATGTCTGTTTCG pLX_317 24.4% 88.3% 87.1% V5 (many diffs) n/a
Download CSV