Transcript: Human XM_011514084.2

PREDICTED: Homo sapiens solute carrier family 1 member 3 (SLC1A3), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC1A3 (6507)
Length:
3645
CDS:
649..1956

Additional Resources:

NCBI RefSeq record:
XM_011514084.2
NBCI Gene record:
SLC1A3 (6507)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011514084.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000421606 ATGTTAGTCTTACCGAATAAG pLKO_005 2173 3UTR 100% 13.200 18.480 N SLC1A3 n/a
2 TRCN0000043194 CCGACCATACAGAATGAGCTA pLKO.1 429 5UTR 100% 2.640 3.696 N SLC1A3 n/a
3 TRCN0000043197 GCGAGCTGTAGTCTATTATAT pLKO.1 690 CDS 100% 15.000 12.000 N SLC1A3 n/a
4 TRCN0000434047 TGTGGCACACAATCCTATAAA pLKO_005 2237 3UTR 100% 15.000 10.500 N SLC1A3 n/a
5 TRCN0000431078 TGAACTGAACTTCGGACAAAT pLKO_005 1584 CDS 100% 13.200 9.240 N SLC1A3 n/a
6 TRCN0000414023 TGCTGTGGTGATTGGCATAAT pLKO_005 726 CDS 100% 13.200 9.240 N Slc1a3 n/a
7 TRCN0000043193 CGACAGTGAAACCAAGATGTA pLKO.1 1935 CDS 100% 4.950 3.465 N SLC1A3 n/a
8 TRCN0000043196 CCACTCCTCTACTTCTTGGTA pLKO.1 1327 CDS 100% 3.000 2.100 N SLC1A3 n/a
9 TRCN0000043195 GCCTGCTTTAAACAGTTTAAA pLKO.1 880 CDS 100% 1.500 1.050 N SLC1A3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011514084.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06955 pDONR223 100% 80.1% 80.2% None 0_1ins321;1125C>A n/a
2 ccsbBroad304_06955 pLX_304 0% 80.1% 80.2% V5 0_1ins321;1125C>A n/a
Download CSV