Transcript: Human XM_011514114.3

PREDICTED: Homo sapiens complement C6 (C6), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
C6 (729)
Length:
3794
CDS:
287..3202

Additional Resources:

NCBI RefSeq record:
XM_011514114.3
NBCI Gene record:
C6 (729)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011514114.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000418474 CATTAAGCATTCTCGCAATTA pLKO_005 3509 3UTR 100% 13.200 18.480 N C6 n/a
2 TRCN0000432220 TGCTTTGTACAGCCGAATATT pLKO_005 1366 CDS 100% 15.000 10.500 N C6 n/a
3 TRCN0000057172 CATGCCTTACTGGCTTTGAAA pLKO.1 2382 CDS 100% 5.625 3.938 N C6 n/a
4 TRCN0000057168 CCAGAGGAGAAGTCCTTGATA pLKO.1 924 CDS 100% 5.625 3.938 N C6 n/a
5 TRCN0000057169 GCCAGAAAGTTAGAATGCAAT pLKO.1 770 CDS 100% 4.950 3.465 N C6 n/a
6 TRCN0000057171 CTTCCAAATGTGTCTGCCTAT pLKO.1 3027 CDS 100% 4.050 2.835 N C6 n/a
7 TRCN0000057170 GCACTTAACCATCTGCCTCTA pLKO.1 1334 CDS 100% 4.050 2.835 N C6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011514114.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05913 pDONR223 100% 96.1% 95.9% None (many diffs) n/a
2 ccsbBroad304_05913 pLX_304 0% 96.1% 95.9% V5 (many diffs) n/a
3 TRCN0000478680 GCACGTCATAGCACAAGCCATACT pLX_317 11.9% 96.1% 95.9% V5 (many diffs) n/a
Download CSV