Transcript: Human XM_011514165.3

PREDICTED: Homo sapiens nucleoporin 155 (NUP155), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NUP155 (9631)
Length:
2893
CDS:
119..2797

Additional Resources:

NCBI RefSeq record:
XM_011514165.3
NBCI Gene record:
NUP155 (9631)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011514165.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000229898 CACAATTGACAGTGATATATT pLKO_005 469 CDS 100% 15.000 10.500 N NUP155 n/a
2 TRCN0000218514 CATGCAGGTGTTAGGTTATAT pLKO_005 1205 CDS 100% 15.000 10.500 N NUP155 n/a
3 TRCN0000229899 ATAGCACTGATGATGCAATTT pLKO_005 2718 CDS 100% 13.200 9.240 N NUP155 n/a
4 TRCN0000059915 CCCTATCCAAATCCATCCTTT pLKO.1 1955 CDS 100% 4.950 3.465 N NUP155 n/a
5 TRCN0000059916 GCAGGCATCTTTCAACCTCAT pLKO.1 578 CDS 100% 4.050 2.835 N NUP155 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011514165.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07454 pDONR223 100% 63.6% 62.9% None (many diffs) n/a
2 ccsbBroad304_07454 pLX_304 0% 63.6% 62.9% V5 (many diffs) n/a
3 TRCN0000492134 TTGAGTGAAGCCCTCCTTAAAAAA pLX_317 9% 63.6% 62.9% V5 (many diffs) n/a
Download CSV