Transcript: Human XM_011514282.3

PREDICTED: Homo sapiens BTB domain containing 9 (BTBD9), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
BTBD9 (114781)
Length:
4431
CDS:
770..1933

Additional Resources:

NCBI RefSeq record:
XM_011514282.3
NBCI Gene record:
BTBD9 (114781)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011514282.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000419346 GGGATATGGACCTCAATTATA pLKO_005 1551 CDS 100% 15.000 10.500 N BTBD9 n/a
2 TRCN0000160249 CTGGCTCATAAATATGGATTT pLKO.1 1115 CDS 100% 10.800 7.560 N BTBD9 n/a
3 TRCN0000160645 CAGCCTTATTAGATGGTGATA pLKO.1 1647 CDS 100% 4.950 3.465 N BTBD9 n/a
4 TRCN0000160053 CCTGGCTCATAAATATGGATT pLKO.1 1114 CDS 100% 4.950 3.465 N BTBD9 n/a
5 TRCN0000158748 GCATTCACAATGCTACTCAAA pLKO.1 1028 CDS 100% 4.950 3.465 N BTBD9 n/a
6 TRCN0000161684 GCAGAAGCATTCACAATGCTA pLKO.1 1022 CDS 100% 0.300 0.210 N BTBD9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011514282.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04659 pDONR223 100% 50.9% 50.3% None (many diffs) n/a
2 ccsbBroad304_04659 pLX_304 0% 50.9% 50.3% V5 (many diffs) n/a
3 TRCN0000466788 CTTGAGATGGGCCAGTAACTGTGC pLX_317 21.5% 50.9% 50.3% V5 (many diffs) n/a
Download CSV