Transcript: Human XM_011514389.2

PREDICTED: Homo sapiens RNA binding motif protein 24 (RBM24), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RBM24 (221662)
Length:
2646
CDS:
484..903

Additional Resources:

NCBI RefSeq record:
XM_011514389.2
NBCI Gene record:
RBM24 (221662)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011514389.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000116199 TGGAGCTGCATACGCACAATA pLKO.1 638 CDS 100% 13.200 18.480 N RBM24 n/a
2 TRCN0000116200 AGCCCTTATACAAAGACCTTT pLKO.1 6 5UTR 100% 4.950 6.930 N RBM24 n/a
3 TRCN0000116197 GCGAGCAATATGTAGCTTGAA pLKO.1 1284 3UTR 100% 4.950 6.930 N RBM24 n/a
4 TRCN0000288874 GCGAGCAATATGTAGCTTGAA pLKO_005 1284 3UTR 100% 4.950 6.930 N RBM24 n/a
5 TRCN0000308070 GCAGACAGACCGAATGCAATA pLKO_005 869 CDS 100% 10.800 7.560 N RBM24 n/a
6 TRCN0000308069 TACCTGCCCACTATGTCTATC pLKO_005 529 CDS 100% 0.000 0.000 N RBM24 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011514389.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05263 pDONR223 100% 66.2% 1.2% None (many diffs) n/a
2 ccsbBroad304_05263 pLX_304 0% 66.2% 1.2% V5 (many diffs) n/a
3 TRCN0000480836 CCGACGAAAAACTATTAGGTTCGT pLX_317 65.6% 66.2% 1.2% V5 (many diffs) n/a
Download CSV