Transcript: Human XM_011514470.2

PREDICTED: Homo sapiens olfactory receptor family 2 subfamily H member 1 (OR2H1), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
OR2H1 (26716)
Length:
3872
CDS:
1893..2843

Additional Resources:

NCBI RefSeq record:
XM_011514470.2
NBCI Gene record:
OR2H1 (26716)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011514470.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000357899 CCTATCACTGTCCATTCTTAA pLKO_005 3067 3UTR 100% 13.200 18.480 N OR2H1 n/a
2 TRCN0000357824 ATGCCTATTTCTGGTTATATA pLKO_005 3151 3UTR 100% 15.000 10.500 N OR2H1 n/a
3 TRCN0000367836 CGAGCACTCAGGAGGTTACTA pLKO_005 2781 CDS 100% 5.625 3.938 N OR2H1 n/a
4 TRCN0000009367 ACCTCTGCTTTACCACAAGTT pLKO.1 2095 CDS 100% 4.950 3.465 N OR2H1 n/a
5 TRCN0000009368 AGCACTGGAAAGGACTCTCTT pLKO.1 1949 CDS 100% 4.950 3.465 N OR2H1 n/a
6 TRCN0000009366 AGGAGGTTACTAGGGAAGGAA pLKO.1 2790 CDS 100% 3.000 2.100 N OR2H1 n/a
7 TRCN0000009365 GCCTGGGTTATGAGTCTGGTT pLKO.1 2328 CDS 100% 2.640 1.848 N OR2H1 n/a
8 TRCN0000357825 AGCTGGAGAGCTGCTTAATAT pLKO_005 2826 CDS 100% 15.000 9.000 N OR2H1 n/a
9 TRCN0000009371 CCTCTTCTACAGCTCAGTCAT pLKO.1 2633 CDS 100% 4.950 2.475 Y OR2H2 n/a
10 TRCN0000188853 GCTCTTCATCTTCCTGTCCTT pLKO.1 2186 CDS 100% 2.640 1.584 N Olfr91 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011514470.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02970 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02970 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000468029 GAGGTTACCGTCTGTAGGGCAGGT pLX_317 35.5% 100% 100% V5 n/a
Download CSV