Transcript: Human XM_011514596.2

PREDICTED: Homo sapiens BCL2 interacting protein 5 (BNIP5), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
BNIP5 (389384)
Length:
4589
CDS:
1032..2990

Additional Resources:

NCBI RefSeq record:
XM_011514596.2
NBCI Gene record:
BNIP5 (389384)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011514596.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000426505 TTAGCTTAGCTAACAAATTTG pLKO_005 2845 CDS 100% 13.200 18.480 N BNIP5 n/a
2 TRCN0000168846 GCCTAAGAGACCACTACAATT pLKO.1 2902 CDS 100% 13.200 10.560 N BNIP5 n/a
3 TRCN0000435478 AGCTGTGTCTTGCACTCAAAT pLKO_005 2992 3UTR 100% 13.200 9.240 N BNIP5 n/a
4 TRCN0000436091 CACAAGTCCTAAGGTTGAAAG pLKO_005 2960 CDS 100% 10.800 7.560 N BNIP5 n/a
5 TRCN0000168552 GTACTGGAGCTTTGGATGTTT pLKO.1 1687 CDS 100% 5.625 3.938 N BNIP5 n/a
6 TRCN0000168867 CCATAAGAAACACACCTCCAA pLKO.1 2363 CDS 100% 2.640 1.848 N BNIP5 n/a
7 TRCN0000168411 GCTGTTAGGAAGAAATCCCAA pLKO.1 1872 CDS 100% 2.640 1.848 N BNIP5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011514596.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05602 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05602 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000476067 CTAGTCACTTACCCACCAATCCGC pLX_317 15% 100% 100% V5 n/a
Download CSV