Transcript: Human XM_011514618.1

PREDICTED: Homo sapiens lymphotoxin alpha (LTA), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LTA (4049)
Length:
1894
CDS:
646..1263

Additional Resources:

NCBI RefSeq record:
XM_011514618.1
NBCI Gene record:
LTA (4049)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011514618.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000364180 GCCCTAGTACTGTCTTCTTTG pLKO_005 1226 CDS 100% 10.800 15.120 N LTA n/a
2 TRCN0000364188 GATCAAGTCACCGGAGCTTTC pLKO_005 1393 3UTR 100% 6.000 8.400 N LTA n/a
3 TRCN0000364191 GCTCCCAGAAGATGGTGTATC pLKO_005 1094 CDS 100% 10.800 7.560 N LTA n/a
4 TRCN0000364189 TGCCTCCATTCTGACCATTTC pLKO_005 1320 3UTR 100% 10.800 7.560 N LTA n/a
5 TRCN0000058205 CCTCAGCCCTAGTACTGTCTT pLKO.1 1221 CDS 100% 4.950 3.465 N LTA n/a
6 TRCN0000058203 CAGTGGCATCTACTTCGTCTA pLKO.1 954 CDS 100% 4.050 2.835 N LTA n/a
7 TRCN0000058206 CTTGAGCAACAATTCTCTCCT pLKO.1 924 CDS 100% 2.640 1.848 N LTA n/a
8 TRCN0000058207 CCAAGATGCATCTTGCCCACA pLKO.1 800 CDS 100% 0.216 0.151 N LTA n/a
9 TRCN0000058204 CCAGCTCTTCTCCTCCCAGTA pLKO.1 1050 CDS 100% 1.350 0.810 N LTA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011514618.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06540 pDONR223 100% 99.8% 99.5% None 37T>C n/a
2 ccsbBroad304_06540 pLX_304 0% 99.8% 99.5% V5 37T>C n/a
3 TRCN0000472975 TCGTCCATGACCTTTGTCAACCAA pLX_317 66.4% 99.8% 99.5% V5 37T>C n/a
Download CSV