Transcript: Human XM_011514739.2

PREDICTED: Homo sapiens TBC1 domain family member 22B (TBC1D22B), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TBC1D22B (55633)
Length:
1400
CDS:
147..1316

Additional Resources:

NCBI RefSeq record:
XM_011514739.2
NBCI Gene record:
TBC1D22B (55633)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011514739.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000257003 GCGGAAGCGGGAGGAATATTT pLKO_005 863 CDS 100% 15.000 10.500 N TBC1D22B n/a
2 TRCN0000243050 CCAGGGAGGTTCGACCTATAA pLKO_005 781 CDS 100% 13.200 9.240 N TBC1D22B n/a
3 TRCN0000219606 GCCAACTACAAGGTCATAAAG pLKO.1 513 CDS 100% 13.200 9.240 N Tbc1d22b n/a
4 TRCN0000243049 GCCAACTACAAGGTCATAAAG pLKO_005 513 CDS 100% 13.200 9.240 N TBC1D22B n/a
5 TRCN0000183722 CCAGAAACTCTAGTGATACAT pLKO.1 556 CDS 100% 5.625 2.813 Y TBC1D22B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011514739.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08559 pDONR223 100% 76.8% 76.8% None (many diffs) n/a
2 ccsbBroad304_08559 pLX_304 0% 76.8% 76.8% V5 (many diffs) n/a
3 TRCN0000473893 TAACCTCGGTCATTCTTTGTGCAA pLX_317 30.7% 76.8% 76.8% V5 (many diffs) n/a
Download CSV