Transcript: Human XM_011514817.3

PREDICTED: Homo sapiens bone morphogenetic protein 5 (BMP5), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
BMP5 (653)
Length:
7603
CDS:
15..1088

Additional Resources:

NCBI RefSeq record:
XM_011514817.3
NBCI Gene record:
BMP5 (653)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011514817.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000371430 TGGACGCAGTATCAACGTAAA pLKO_005 845 CDS 100% 10.800 15.120 N BMP5 n/a
2 TRCN0000058268 CCAGCAATCATTGGGTGATTA pLKO.1 778 CDS 100% 1.320 1.848 N BMP5 n/a
3 TRCN0000058272 GCACCTCTCTTTATGCTGGAT pLKO.1 243 CDS 100% 2.640 2.112 N BMP5 n/a
4 TRCN0000058269 CGGAGCAACAACCGATTTGAA pLKO.1 624 CDS 100% 5.625 3.938 N BMP5 n/a
5 TRCN0000058271 GACGGGAAATACAAAGGGAAA pLKO.1 157 CDS 100% 4.050 2.835 N BMP5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011514817.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00166 pDONR223 100% 77.9% 74.4% None (many diffs) n/a
2 ccsbBroad304_00166 pLX_304 0% 77.9% 74.4% V5 (many diffs) n/a
3 TRCN0000472902 ATCCAAGTAAGTCGTATTTTTTTA pLX_317 33.5% 77.9% 74.4% V5 (many diffs) n/a
Download CSV