Transcript: Human XM_011514873.2

PREDICTED: Homo sapiens zinc finger with KRAB and SCAN domains 8 (ZKSCAN8), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZKSCAN8 (7745)
Length:
7593
CDS:
974..2149

Additional Resources:

NCBI RefSeq record:
XM_011514873.2
NBCI Gene record:
ZKSCAN8 (7745)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011514873.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000230117 ATCTGAATCCATAAGCGTTTA pLKO_005 2128 CDS 100% 10.800 15.120 N ZKSCAN8 n/a
2 TRCN0000013016 CCCTATTAGAGGATTTGGAAA pLKO.1 769 5UTR 100% 4.950 6.930 N ZKSCAN8 n/a
3 TRCN0000230118 AGTATCACCAGGCACTATATT pLKO_005 3402 3UTR 100% 15.000 12.000 N ZKSCAN8 n/a
4 TRCN0000217953 ACACAAGAGAGACGACATAAA pLKO_005 1361 CDS 100% 13.200 9.240 N ZKSCAN8 n/a
5 TRCN0000230116 TTTGGAAAGGCAGATTGATAT pLKO_005 782 5UTR 100% 13.200 9.240 N ZKSCAN8 n/a
6 TRCN0000230115 GAGCTCCAGACACTGGTTAAG pLKO_005 714 5UTR 100% 10.800 7.560 N ZKSCAN8 n/a
7 TRCN0000013015 CCCTTCTTTCACATCAGGATA pLKO.1 1503 CDS 100% 4.950 3.465 N ZKSCAN8 n/a
8 TRCN0000013013 GCCAGAACTTACGCATCCAAT pLKO.1 3491 3UTR 100% 4.950 3.465 N ZKSCAN8 n/a
9 TRCN0000013017 GCTTCTTGATCCATCACAGAA pLKO.1 1114 CDS 100% 4.950 3.465 N ZKSCAN8 n/a
10 TRCN0000013014 CCAGATTTGAACACCAAGGAA pLKO.1 642 5UTR 100% 3.000 2.100 N ZKSCAN8 n/a
11 TRCN0000095901 GACGACATAAATGTGATGAAT pLKO.1 1371 CDS 100% 5.625 3.375 N Zkscan8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011514873.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01816 pDONR223 100% 67.6% 67.6% None 0_1ins561 n/a
2 ccsbBroad304_01816 pLX_304 0% 67.6% 67.6% V5 0_1ins561 n/a
3 TRCN0000477419 CGGGCTCGAAACTTATCCGTGGAC pLX_317 22.7% 67.6% 67.6% V5 0_1ins561 n/a
4 ccsbBroadEn_07171 pDONR223 100% 67.6% 67.6% None 0_1ins561 n/a
5 ccsbBroad304_07171 pLX_304 0% 67.6% 67.6% V5 0_1ins561 n/a
6 TRCN0000473447 CCGAGAACCACTAAGGGCTCACAT pLX_317 31.3% 67.6% 67.6% V5 0_1ins561 n/a
Download CSV