Transcript: Human XM_011515058.2

PREDICTED: Homo sapiens IKAROS family zinc finger 1 (IKZF1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
IKZF1 (10320)
Length:
6176
CDS:
27..1718

Additional Resources:

NCBI RefSeq record:
XM_011515058.2
NBCI Gene record:
IKZF1 (10320)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011515058.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000236421 TATTGTGGCCGAAGCTATAAA pLKO_005 771 CDS 100% 15.000 21.000 N IKZF1 n/a
2 TRCN0000107874 CGCCAAACGTAAGAGCTCTAT pLKO.1 971 CDS 100% 4.950 6.930 N IKZF1 n/a
3 TRCN0000107871 GCGGAGGATTTACGAATGCTT pLKO.1 393 CDS 100% 3.000 4.200 N IKZF1 n/a
4 TRCN0000244221 GTGATATCTGTGGGATCATTT pLKO_005 514 CDS 100% 13.200 10.560 N IKZF1 n/a
5 TRCN0000236419 CCGCTTCCACATGAGCTAAAG pLKO_005 1700 CDS 100% 10.800 8.640 N IKZF1 n/a
6 TRCN0000107870 GCTATCAATCATTAAGGTCAT pLKO.1 3238 3UTR 100% 4.050 3.240 N IKZF1 n/a
7 TRCN0000236420 GCATTTGGAAACGGGAATAAA pLKO_005 3874 3UTR 100% 15.000 10.500 N IKZF1 n/a
8 TRCN0000107872 CCGTTGGTAAACCTCACAAAT pLKO.1 745 CDS 100% 13.200 9.240 N IKZF1 n/a
9 TRCN0000236422 CTACGAGAAGGAGAACGAAAT pLKO_005 1052 CDS 100% 10.800 7.560 N IKZF1 n/a
10 TRCN0000107873 GCCGAAGCTATAAACAGCGAA pLKO.1 778 CDS 100% 2.640 1.848 N IKZF1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011515058.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11482 pDONR223 100% 84.7% 84.5% None 1_72del;233_292del;721_846del n/a
2 ccsbBroad304_11482 pLX_304 0% 84.7% 84.5% V5 1_72del;233_292del;721_846del n/a
3 TRCN0000479864 CTGCACAGGTGAAGTGAGACAATT pLX_317 16.8% 84.7% 84.5% V5 1_72del;233_292del;721_846del n/a
Download CSV