Transcript: Human XM_011515164.1

PREDICTED: Homo sapiens transmembrane protein 184A (TMEM184A), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TMEM184A (202915)
Length:
2282
CDS:
318..1583

Additional Resources:

NCBI RefSeq record:
XM_011515164.1
NBCI Gene record:
TMEM184A (202915)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011515164.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000243149 TACGAAGCCTTTGTCATTTAC pLKO_005 696 CDS 100% 13.200 9.240 N TMEM184A n/a
2 TRCN0000243150 TCAAGTTCCTCACCATCAAAG pLKO_005 1082 CDS 100% 10.800 7.560 N TMEM184A n/a
3 TRCN0000243147 GGCTGTGGGAATCGCTCTTAT pLKO_005 2235 3UTR 100% 13.200 7.920 N TMEM184A n/a
4 TRCN0000243148 TCACCTGCCACCAGATCTATC pLKO_005 523 CDS 100% 10.800 6.480 N TMEM184A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011515164.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13395 pDONR223 100% 88.7% 41.5% None (many diffs) n/a
2 ccsbBroad304_13395 pLX_304 0% 88.7% 41.5% V5 (many diffs) n/a
3 TRCN0000473308 CACAAAATAAATTTCGTTCTGTTT pLX_317 24% 88.7% 41.5% V5 (many diffs) n/a
Download CSV