Transcript: Human XM_011515335.2

PREDICTED: Homo sapiens acyloxyacyl hydrolase (AOAH), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
AOAH (313)
Length:
3467
CDS:
534..2477

Additional Resources:

NCBI RefSeq record:
XM_011515335.2
NBCI Gene record:
AOAH (313)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011515335.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000371261 ACTATCCCGCCATCGTTATAT pLKO_005 1492 CDS 100% 15.000 21.000 N AOAH n/a
2 TRCN0000050061 CCATCAGGATTCAAACTGTAA pLKO.1 1082 CDS 100% 4.950 6.930 N AOAH n/a
3 TRCN0000050058 CGGCCAGCTAAATAAAGACAT pLKO.1 1715 CDS 100% 4.950 3.960 N AOAH n/a
4 TRCN0000371260 AGACTCTGAAGCATCTAAATT pLKO_005 1603 CDS 100% 15.000 10.500 N AOAH n/a
5 TRCN0000050060 CCAACCATTGTGTCATCTCTA pLKO.1 767 CDS 100% 4.950 3.465 N AOAH n/a
6 TRCN0000050059 GCAGATGTCTTTGAACTCTTT pLKO.1 1244 CDS 100% 4.950 3.465 N AOAH n/a
7 TRCN0000050062 GCAGTTGTACTCCTTCCTGAA pLKO.1 1745 CDS 100% 4.050 2.835 N AOAH n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011515335.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05828 pDONR223 100% 77.5% 70.9% None (many diffs) n/a
2 ccsbBroad304_05828 pLX_304 0% 77.5% 70.9% V5 (many diffs) n/a
3 TRCN0000473373 GAATTAGGATAACCACCATAATCT pLX_317 30.9% 77.5% 70.9% V5 (many diffs) n/a
Download CSV