Transcript: Human XM_011515444.2

PREDICTED: Homo sapiens carbohydrate sulfotransferase 12 (CHST12), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CHST12 (55501)
Length:
1536
CDS:
140..1384

Additional Resources:

NCBI RefSeq record:
XM_011515444.2
NBCI Gene record:
CHST12 (55501)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011515444.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000035941 CGACGAGTTTCTGGACAAGTT pLKO.1 337 CDS 100% 4.950 6.930 N CHST12 n/a
2 TRCN0000436865 GTGCCAGATCGACTACGACTT pLKO_005 1132 CDS 100% 4.050 5.670 N CHST12 n/a
3 TRCN0000035943 GCAGCTGTATAAACTCTACGA pLKO.1 1309 CDS 100% 2.640 3.696 N CHST12 n/a
4 TRCN0000035942 CGCGCACCTGACCTTCAACAA pLKO.1 772 CDS 100% 1.650 2.310 N CHST12 n/a
5 TRCN0000419854 TTGAGTACTGTATCGATATTG pLKO_005 1502 3UTR 100% 13.200 9.240 N CHST12 n/a
6 TRCN0000035939 GCTCAAGAAGTACACCAAGTT pLKO.1 841 CDS 100% 4.950 3.465 N CHST12 n/a
7 TRCN0000035940 CGACTTTGTTCTCTTCGGCTA pLKO.1 1333 CDS 100% 2.160 1.512 N CHST12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011515444.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03592 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03592 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000480263 ATTAGACCATCAATGAGCTGTCCT pLX_317 28.2% 100% 100% V5 n/a
Download CSV